sgrna1 expression vector targeting monitoring cell line Search Results


93
Addgene inc sgrna1
Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/bio_rxiv__2023__01__31__526410-116-6-22?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sgrna1 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc plenticrisprv2 plasmids targeting gilt
Plenticrisprv2 Plasmids Targeting Gilt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pmc06818130-47-29-42?v=Addgene+inc
Average 93 stars, based on 1 article reviews
plenticrisprv2 plasmids targeting gilt - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

86
Twist Bioscience tobacco rattle virus rna2 ptrv2 vectors ptrv2 sgrna1 sgrna2
Tobacco Rattle Virus Rna2 Ptrv2 Vectors Ptrv2 Sgrna1 Sgrna2, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pm41683941-248-0-18?v=Twist+Bioscience
Average 86 stars, based on 1 article reviews
tobacco rattle virus rna2 ptrv2 vectors ptrv2 sgrna1 sgrna2 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

93
Addgene inc guide sequences 5 gtgcaaatataaatagaggg 3
Guide Sequences 5 Gtgcaaatataaatagaggg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pmc10565626-165-0-21?v=Addgene+inc
Average 93 stars, based on 1 article reviews
guide sequences 5 gtgcaaatataaatagaggg 3 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

92
Addgene inc sgrna 1
Sgrna 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pm37511594-284-8-18?v=Addgene+inc
Average 92 stars, based on 1 article reviews
sgrna 1 - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

96
Addgene inc 50 ccttgccaggagtt actgcg 30
50 Ccttgccaggagtt Actgcg 30, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pm34910912-317-18-26?v=Addgene+inc
Average 96 stars, based on 1 article reviews
50 ccttgccaggagtt actgcg 30 - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

93
Addgene inc sirt6 sgrna1 cctgaagtcggggatgccag
(A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant <t>Sirt6</t> and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.
Sirt6 Sgrna1 Cctgaagtcggggatgccag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/bio_rxiv__2024__09__28__615627-122-45-70?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sirt6 sgrna1 cctgaagtcggggatgccag - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Addgene inc sgrna1 expression vector targeting monitoring cell line
(A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant <t>Sirt6</t> and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.
Sgrna1 Expression Vector Targeting Monitoring Cell Line, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pmc07957797__ijms___22___02407___s001-20-37-24?v=Addgene+inc
Average 90 stars, based on 1 article reviews
sgrna1 expression vector targeting monitoring cell line - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

92
Addgene inc kat2a sgrna
(A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant <t>Sirt6</t> and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.
Kat2a Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pmc07245572-953-15-21?v=Addgene+inc
Average 92 stars, based on 1 article reviews
kat2a sgrna - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
VectorBuilder GmbH sgrna vector plv-u6>sgrna1-u6>sgrna2-u6>sgrna3-u6>sgrna4
( A ) RT-PCR results for the RNA expression levels of the STADT barcode and Cas9 in cells growing in the presence of different concentrations of cumate. GAPDH was used as an internal control. The STADT barcode and Cas9 were amplified for 30 cycles, while GAPDH was amplified for 26 cycles. ( B ) RT-qPCR results for the expression levels of the STADT barcode relative to those of GAPDH. ( C ) RT-qPCR results for the expression levels of the Cas9 gene relative to those of GAPDH in cells cultured with different concentrations of cumate. ( D ) Western blot of the expression levels of Cas9 in cells cultured with different concentrations of cumate. GAPDH was used as an internal control. The small bands (*) may have resulted from the degradation of the Cas9 protein. ( E ) RT-PCR results showing the expression levels of <t>sgRNA1</t> in the cells infected with different MOIs (0.1, 30) of the <t>sgRNA</t> lentivirus. U6 was used as an internal control. sgRNA1 was amplified for 35 cycles, while U6 was amplified for 30 cycles. ( F ) RT-qPCR result showing the expression level of sgRNA1 relative to that of U6 in the cell lines infected with different MOIs (0.1, 30) of the sgRNA lentivirus.
Sgrna Vector Plv U6>Sgrna1 U6>Sgrna2 U6>Sgrna3 U6>Sgrna4, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/bio_rxiv__2021__11__24__469964-155-20-23?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
sgrna vector plv-u6>sgrna1-u6>sgrna2-u6>sgrna3-u6>sgrna4 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

92
Addgene inc comtd1
( A ) RT-PCR results for the RNA expression levels of the STADT barcode and Cas9 in cells growing in the presence of different concentrations of cumate. GAPDH was used as an internal control. The STADT barcode and Cas9 were amplified for 30 cycles, while GAPDH was amplified for 26 cycles. ( B ) RT-qPCR results for the expression levels of the STADT barcode relative to those of GAPDH. ( C ) RT-qPCR results for the expression levels of the Cas9 gene relative to those of GAPDH in cells cultured with different concentrations of cumate. ( D ) Western blot of the expression levels of Cas9 in cells cultured with different concentrations of cumate. GAPDH was used as an internal control. The small bands (*) may have resulted from the degradation of the Cas9 protein. ( E ) RT-PCR results showing the expression levels of <t>sgRNA1</t> in the cells infected with different MOIs (0.1, 30) of the <t>sgRNA</t> lentivirus. U6 was used as an internal control. sgRNA1 was amplified for 35 cycles, while U6 was amplified for 30 cycles. ( F ) RT-qPCR result showing the expression level of sgRNA1 relative to that of U6 in the cell lines infected with different MOIs (0.1, 30) of the sgRNA lentivirus.
Comtd1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pm37068079-281-6-24?v=Addgene+inc
Average 92 stars, based on 1 article reviews
comtd1 - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
Addgene inc ctbp 1 sgrna 1 expression vector 5 ggtgttaaatgaagctgtgg
( A ) RT-PCR results for the RNA expression levels of the STADT barcode and Cas9 in cells growing in the presence of different concentrations of cumate. GAPDH was used as an internal control. The STADT barcode and Cas9 were amplified for 30 cycles, while GAPDH was amplified for 26 cycles. ( B ) RT-qPCR results for the expression levels of the STADT barcode relative to those of GAPDH. ( C ) RT-qPCR results for the expression levels of the Cas9 gene relative to those of GAPDH in cells cultured with different concentrations of cumate. ( D ) Western blot of the expression levels of Cas9 in cells cultured with different concentrations of cumate. GAPDH was used as an internal control. The small bands (*) may have resulted from the degradation of the Cas9 protein. ( E ) RT-PCR results showing the expression levels of <t>sgRNA1</t> in the cells infected with different MOIs (0.1, 30) of the <t>sgRNA</t> lentivirus. U6 was used as an internal control. sgRNA1 was amplified for 35 cycles, while U6 was amplified for 30 cycles. ( F ) RT-qPCR result showing the expression level of sgRNA1 relative to that of U6 in the cell lines infected with different MOIs (0.1, 30) of the sgRNA lentivirus.
Ctbp 1 Sgrna 1 Expression Vector 5 Ggtgttaaatgaagctgtgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna1+expression+vector+targeting+monitoring+cell+line/pm32994172-541-21-57?v=Addgene+inc
Average 90 stars, based on 1 article reviews
ctbp 1 sgrna 1 expression vector 5 ggtgttaaatgaagctgtgg - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


(A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant Sirt6 and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant Sirt6 and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Isolation, Incubation, Recombinant, Quantitation Assay, Staining, Control, Concentration Assay

(A) Western blot using a pan-lactyllysine antibody to analyze Kla levels on acid-extracted histones from wild type (“WT”), Sirt6 knockout (“S6KO”), and Sirt7 knockout (“S7KO”) U2OS cells in the presence of a titration of sodium L-lactate. Total protein was measured using a fluorescent total protein stain. (B) As in panel A but using a pan-acetyllysine antibody to analyze levels of histone Kac. (C) Western blots from panel A quantified by normalizing Kla signal to total protein then represented as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test. p (slope, S6KO v. WT) < 0.0001. p (slope, S7KO v. WT) = 0.39. (D) Western blots from panel B quantified by normalizing Kac signal to total protein then represented as a fold-change from the untreated condition. For WT and S6KO, n=3. For S7KO, n=2. Error plotted as S.D. (E) Baseline histone lactylation in untreated cells was measured using a pan-Kla antibody as in panel A and normalized to the loading control. The blot images used to generate this plot are shown in . Error plotted as S.D., p = 0.68.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot using a pan-lactyllysine antibody to analyze Kla levels on acid-extracted histones from wild type (“WT”), Sirt6 knockout (“S6KO”), and Sirt7 knockout (“S7KO”) U2OS cells in the presence of a titration of sodium L-lactate. Total protein was measured using a fluorescent total protein stain. (B) As in panel A but using a pan-acetyllysine antibody to analyze levels of histone Kac. (C) Western blots from panel A quantified by normalizing Kla signal to total protein then represented as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test. p (slope, S6KO v. WT) < 0.0001. p (slope, S7KO v. WT) = 0.39. (D) Western blots from panel B quantified by normalizing Kac signal to total protein then represented as a fold-change from the untreated condition. For WT and S6KO, n=3. For S7KO, n=2. Error plotted as S.D. (E) Baseline histone lactylation in untreated cells was measured using a pan-Kla antibody as in panel A and normalized to the loading control. The blot images used to generate this plot are shown in . Error plotted as S.D., p = 0.68.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Knock-Out, Titration, Staining, Control

(A) Western blot using a pan-lactyllysine antibody (PTM BIO) to analyze Kla levels on acid-extracted histones from wild type and Sirt6 knockout U2OS cells in the presence of a titration of rotenone, a mitochondrial Complex I inhibitor. Total protein was measured using a fluorescent total protein stain (LI-COR). (B) Antibody signal was corrected based on the loading control signal, then normalized as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test, p=0.0005 (C) As in panel A but using the pan-acetyllysine antibody to measure levels of histone Kac. (D) Quantitation of data from panel C. Data were processed as in panel B. n=3, error plotted as S.D.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot using a pan-lactyllysine antibody (PTM BIO) to analyze Kla levels on acid-extracted histones from wild type and Sirt6 knockout U2OS cells in the presence of a titration of rotenone, a mitochondrial Complex I inhibitor. Total protein was measured using a fluorescent total protein stain (LI-COR). (B) Antibody signal was corrected based on the loading control signal, then normalized as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test, p=0.0005 (C) As in panel A but using the pan-acetyllysine antibody to measure levels of histone Kac. (D) Quantitation of data from panel C. Data were processed as in panel B. n=3, error plotted as S.D.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Knock-Out, Titration, Staining, Control, Quantitation Assay

(A) Levels of various histone acyl PTMs on acid-extracted histones from wild type or Sirt6 knockout U2OS cells were measured using site-specific antibodies (CST and PTM BIO). Total protein in each sample was measured using a fluorescent total protein stain (LI-COR). (B) Quantitation of data from panel A. Data were corrected based on the Revert 700 total protein stain, then normalized to the - Lactate control condition. Statistical analysis was performed using Student’s t-test and corrected for multiple hypothesis testing using the Holm-Šídák correction. n=3, error plotted as S.D. H3K9La p=0.013, H3K18La p=0.019.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Levels of various histone acyl PTMs on acid-extracted histones from wild type or Sirt6 knockout U2OS cells were measured using site-specific antibodies (CST and PTM BIO). Total protein in each sample was measured using a fluorescent total protein stain (LI-COR). (B) Quantitation of data from panel A. Data were corrected based on the Revert 700 total protein stain, then normalized to the - Lactate control condition. Statistical analysis was performed using Student’s t-test and corrected for multiple hypothesis testing using the Holm-Šídák correction. n=3, error plotted as S.D. H3K9La p=0.013, H3K18La p=0.019.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Knock-Out, Staining, Quantitation Assay, Control

(A) Western blot measuring histone Kla on acid-extracted histones in WT and Sirt6-KO U2OS cell lines not treated with supplemental L-lactate with and without overexpression of human Sir6 under the control of a CMV promoter. WT histone H3 (CST) is used as a loading control. (B) Western blot measuring Sirt6 in the soluble protein fraction from cell lines from (a). β-Actin is used as a loading control. (C) Kla signal from (a) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. (D) as in (a) but measuring histone Kac. (E) as in (c), but for Kac data from (d) (F) As in (a), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to histone extraction. (G) As in (b), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to cell lysis. (H) Kla signal from (f) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. (I) Inverse correlation of data from (f) and (g). Sirt6 signal was normalized by dividing by the β-actin loading control. Kla signal was normalized as in (h). The data were analyzed using a standard linear regression, R 2 = 0.84.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot measuring histone Kla on acid-extracted histones in WT and Sirt6-KO U2OS cell lines not treated with supplemental L-lactate with and without overexpression of human Sir6 under the control of a CMV promoter. WT histone H3 (CST) is used as a loading control. (B) Western blot measuring Sirt6 in the soluble protein fraction from cell lines from (a). β-Actin is used as a loading control. (C) Kla signal from (a) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. (D) as in (a) but measuring histone Kac. (E) as in (c), but for Kac data from (d) (F) As in (a), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to histone extraction. (G) As in (b), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to cell lysis. (H) Kla signal from (f) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. (I) Inverse correlation of data from (f) and (g). Sirt6 signal was normalized by dividing by the β-actin loading control. Kla signal was normalized as in (h). The data were analyzed using a standard linear regression, R 2 = 0.84.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Over Expression, Control, Extraction, Lysis

(A) Western blot measuring histone Kla in WT and Sirt6-KO U2OS cells treated with sodium L-lactate and panobinostat, as indicated. A total protein stain (LI-COR) was used as a loading control. (B) As in panel A but measuring histone Kac. (C) Quantitation of selected data from panel A. Histone Kla signal was quantified using densitometry and corrected based on the total protein stain. Data are presented as a fold change from the untreated (-lactate, -panobinostat) condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. p 1 = 0.03, p 2 = 0.02, p 3 =0.005, p 4 =0.002. n=3, error plotted as s.d. (D) Quantitation of selected data from panel B. Data was processed as in panel C. n=3, error plotted as s.d. Quantitation of additional conditions is available in figure S4.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot measuring histone Kla in WT and Sirt6-KO U2OS cells treated with sodium L-lactate and panobinostat, as indicated. A total protein stain (LI-COR) was used as a loading control. (B) As in panel A but measuring histone Kac. (C) Quantitation of selected data from panel A. Histone Kla signal was quantified using densitometry and corrected based on the total protein stain. Data are presented as a fold change from the untreated (-lactate, -panobinostat) condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. p 1 = 0.03, p 2 = 0.02, p 3 =0.005, p 4 =0.002. n=3, error plotted as s.d. (D) Quantitation of selected data from panel B. Data was processed as in panel C. n=3, error plotted as s.d. Quantitation of additional conditions is available in figure S4.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Staining, Control, Quantitation Assay

( A ) RT-PCR results for the RNA expression levels of the STADT barcode and Cas9 in cells growing in the presence of different concentrations of cumate. GAPDH was used as an internal control. The STADT barcode and Cas9 were amplified for 30 cycles, while GAPDH was amplified for 26 cycles. ( B ) RT-qPCR results for the expression levels of the STADT barcode relative to those of GAPDH. ( C ) RT-qPCR results for the expression levels of the Cas9 gene relative to those of GAPDH in cells cultured with different concentrations of cumate. ( D ) Western blot of the expression levels of Cas9 in cells cultured with different concentrations of cumate. GAPDH was used as an internal control. The small bands (*) may have resulted from the degradation of the Cas9 protein. ( E ) RT-PCR results showing the expression levels of sgRNA1 in the cells infected with different MOIs (0.1, 30) of the sgRNA lentivirus. U6 was used as an internal control. sgRNA1 was amplified for 35 cycles, while U6 was amplified for 30 cycles. ( F ) RT-qPCR result showing the expression level of sgRNA1 relative to that of U6 in the cell lines infected with different MOIs (0.1, 30) of the sgRNA lentivirus.

Journal: bioRxiv

Article Title: A high-density lineage tree reveals dynamics of expression differences accumulation in nondifferentiating clonal expansion

doi: 10.1101/2021.11.24.469964

Figure Lengend Snippet: ( A ) RT-PCR results for the RNA expression levels of the STADT barcode and Cas9 in cells growing in the presence of different concentrations of cumate. GAPDH was used as an internal control. The STADT barcode and Cas9 were amplified for 30 cycles, while GAPDH was amplified for 26 cycles. ( B ) RT-qPCR results for the expression levels of the STADT barcode relative to those of GAPDH. ( C ) RT-qPCR results for the expression levels of the Cas9 gene relative to those of GAPDH in cells cultured with different concentrations of cumate. ( D ) Western blot of the expression levels of Cas9 in cells cultured with different concentrations of cumate. GAPDH was used as an internal control. The small bands (*) may have resulted from the degradation of the Cas9 protein. ( E ) RT-PCR results showing the expression levels of sgRNA1 in the cells infected with different MOIs (0.1, 30) of the sgRNA lentivirus. U6 was used as an internal control. sgRNA1 was amplified for 35 cycles, while U6 was amplified for 30 cycles. ( F ) RT-qPCR result showing the expression level of sgRNA1 relative to that of U6 in the cell lines infected with different MOIs (0.1, 30) of the sgRNA lentivirus.

Article Snippet: For the sgRNAs, two DNA cassettes, U6>sgRNA1-U6>sgRNA2 and U6>sgRNA3-U6>sgRNA4, were synthesized and subsequently combined by Golden Gate ligation in the sgRNA vector pLV-U6>sgRNA1-U6>sgRNA2-U6>sgRNA3-U6>sgRNA4 (VectorBuilder, no. VB180515-1178wxn).

Techniques: Reverse Transcription Polymerase Chain Reaction, RNA Expression, Amplification, Quantitative RT-PCR, Expressing, Cell Culture, Western Blot, Infection